Animal 'bar codes' to take over from Latin names

The names don't exactly trip off the tongue. But the official Latin monikers used to catalogue the world's animal species are about to be replaced – with the sort of bar code normally seen on a baked bean tin.

The names don't exactly trip off the tongue. But the official Latin monikers used to catalogue the world's animal species are about to be replaced – with the sort of bar code normally seen on a baked bean tin.

For the past two and a half centuries, scientists examining new species have allocated them to the right family with a description based on a Latin root – making sure, of course, not to confuse an Arbitrarus conventicus with a Revisionus conventicus – and also carefully catalogued them according to their appearance.

But there are fewer and fewer people able to do this work, and it is also painfully slow. Over the past 250 years, only a modest 1.2 million species have been described and named. With an estimated 10 million animal species still to be recorded, there are fears that many could disappear before they are properly catalogued.

Today 40 leading scientists involved in taxonomy – the classification of organisms – will meet in New York with the aim of setting up an international bar-coding system using individual DNA as labels for new species. Existing species will get their own bar code, too.

With the right technology, says a report co-authored by scientists at the Natural History Museum, in London, up to 1,000 species a day could be bar coded by just one institution. And that, say scientists, will make it possible to catalogue animal life on the planet within two decades, 1,000 or so years sooner than under the current system.

Scientists say that the retail industry's coding system employs 10 digits to create 100 billion different combinations, or bar codes, that are in turn allocated to specific products ranging from canned beans to electronics.

DNA is also encoded, using four chemical bases – adenine (A), cytosine (C), guanine (G) and thymine (T) – and the genomes of most species are millions of these nucleotides long. The sequence for every living organism is different, and just using a fraction of the sequence would provide more than one billion bar code options.

Although new species may have a bar code only, existing species will keep their Latin names too. The bar code for an African elephant (Loxodonta africana), for example, would be made up of thick and thin lines representing the four chemical bases using the letters AACACTGTATCTATTATTTG, while the domestic cat would be TACTCTTTACCTTTTATTCG.

"The proper naming of species has become a serious bottleneck," says Professor Paul Hebert, of the University of Guelph, in Canada, who will be at today's meeting. "I do think it is a serious problem, and I believe the move to DNA-based taxonomy will lead to a new approach to the description of species. After the bar coding, those who then want to name and describe species can come along over the next 2,000 years or so – because that's how long it would take – and do so. What we are saying is that there is a need to bring modern technology to the task of species recognition. We also suggest that nature has been kind enough to embed every life form with a 'bar code' and all we need to do is read it."

Dr Richard Thomas, of the Natural History Museum, and co-author of a report published this week in Trends in Ecology and Evolution, said: "We think DNA will be very useful for groups of species that have a lot of diversity in them. With the use of DNA, a species could be described and catalogued. Some groups suggest that a DNA bar code would be sufficient, but I believe that we would still want to come back and name them, possibly at a later date.

"Another advantage of bar codes is that the information is digital and not influenced by subjective assessments. It would be reproducible at any time and by any person, speaking any language."

The report reveals the speed with which bar coding – illustrated above in mock-up form for a polar bear and an African elephant – could be done.

The report states: "Establishment of a DNA facility that could routinely handle 1,000 samples per day would cost approximately as much as a facility that runs a transmission and a scanning electron microscope. The material costs for each sample, including DNA extraction and sequencing of two independent regions, would be five euros per sample."

Just what Darwin would make of it is not clear, but Dr Thomas believes he would be in favour: "I think he would really love it," he said.